I dunno, I tried it as username and password on ware Tech (not at the same time) got nothing
The Monarch Repository?
CODE -5
Monarch Repository : Data Loss Imminent
Booting up Command.Center.v11
Pending approval by Monarch
Error- Unable to connect with repository
WARNING- MEMORY DUMP FAILED!
Biometric backup initiated…
we had something earlier in WT with Monarch
“Protect the Monarch”
Discord explained that the image reveals this for anyone unclear (like me) how things progressed so quickly.
The molecules above are various nucleotides (adenine, guanine, thymine, cytosine).
When listed in order, the first letters of each word form the string ATTGATGAAAATACTATCACCTAT
Translating that nucleotide sequence to a protein sequence yields the string IDENTITY
posted by someone called Saviour
daiyum…
Chemical structure.
maybe something to help with the 3 corrupted dreamers ?
I beat you
no i had to edit the title lol
hmmm yes looks like chemical compound structures, however I think its more to do with the patterns - one of the patterns appears on all the lines.
a pattern cypher ?
I wonder if it has something to do with a huge Fauna update
We got it come over! We as in csd I helped not at all
Darn it, I knew that looked awfully familiar. Was thinking chemistry, but didn’t make the link to carbohydrates…
Thank you for sharing this. If there is one complaint I have about this ARG it is people posting stuff without an explanation. It gets under my skin so bad. What is the point of getting all excited over the answer if you don’t understand it and/or learn from it? To each their own, I guess. [shrugs]
For me, it’s just that someone else always finds it before I do XD
Yeah time to break out the chemistry bond line notebook from 11th grade, hope I remember it well enough
Freaking super smart people here and in discord that’s for sure!